b3 primers Search Results


ccttcaactcctcaagatctacttgcc eurofins scientific n a primer  (Eurofins)
86
Eurofins ccttcaactcctcaagatctacttgcc eurofins scientific n a primer
Ccttcaactcctcaagatctacttgcc Eurofins Scientific N A Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b3+primers/a+agg+b3+ephrin+eurofins+fw+gct+ggg+gtt+hybridization+in+n+primer+probe+scientific+situ+tgc+ttt/pm36736320-131-22-23
Average 86 stars, based on 1 article reviews
ccttcaactcctcaagatctacttgcc eurofins scientific n a primer - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier
outer primers f3 and b3  (Eiken Chemical)
90
Eiken Chemical outer primers f3 and b3
Outer Primers F3 And B3, supplied by Eiken Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b3+primers/outer+primers+f3+and+b3/pmc03516274-61-40-49
Average 90 stars, based on 1 article reviews
outer primers f3 and b3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
outer primers (f3, b3)  (Eiken Chemical)
90
Eiken Chemical outer primers (f3, b3)
Outer Primers (F3, B3), supplied by Eiken Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b3+primers/outer+primers++f3++b3+/pm24713896-38-10-39
Average 90 stars, based on 1 article reviews
outer primers (f3, b3) - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
outer backward primer (b3)  (Microsynth ag)
90
Microsynth ag outer backward primer (b3)
List of primers used, their source, and expected product size
Outer Backward Primer (B3), supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b3+primers/outer+backward+primer++b3+/pmc07036428-76-40-74
Average 90 stars, based on 1 article reviews
outer backward primer (b3) - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
lamp outer primers f3 and b3  (PrimerDesign Inc)
90
PrimerDesign Inc lamp outer primers f3 and b3
List of primers used, their source, and expected product size
Lamp Outer Primers F3 And B3, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b3+primers/lamp+outer+primers+f3+and+b3/pmc12102175-158-1-27
Average 90 stars, based on 1 article reviews
lamp outer primers f3 and b3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
backward outer primer b3  (Eiken Chemical)
90
Eiken Chemical backward outer primer b3
List of primers used, their source, and expected product size
Backward Outer Primer B3, supplied by Eiken Chemical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b3+primers/backward+outer+primer+b3/pmc03599137-120-4-56
Average 90 stars, based on 1 article reviews
backward outer primer b3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
lamp primers f3 and b3  (Ward Medic Ltd)
90
Ward Medic Ltd lamp primers f3 and b3
List of primers used, their source, and expected product size
Lamp Primers F3 And B3, supplied by Ward Medic Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b3+primers/lamp+primers+f3+and+b3/pmc09047130-104-15-27
Average 90 stars, based on 1 article reviews
lamp primers f3 and b3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
forward and backward outer primers (f3/b3)  (OptiGene Ltd)
90
OptiGene Ltd forward and backward outer primers (f3/b3)
List of primers used, their source, and expected product size
Forward And Backward Outer Primers (F3/B3), supplied by OptiGene Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b3+primers/forward+and+backward+outer+primers++f3+b3+/10__1016_slash_j__foodcont__2021__107973-62-8-40
Average 90 stars, based on 1 article reviews
forward and backward outer primers (f3/b3) - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
primers of fip, bip, f3, and b3  (Federation of European Neuroscience Societies)
90
Federation of European Neuroscience Societies primers of fip, bip, f3, and b3
List of primers used, their source, and expected product size
Primers Of Fip, Bip, F3, And B3, supplied by Federation of European Neuroscience Societies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b3+primers/primers+of+fip++bip++f3++and+b3/10__1111_slash_j__1574___695x__2010__00728__x-34-3-30
Average 90 stars, based on 1 article reviews
primers of fip, bip, f3, and b3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
lamp primers f3, b3, fip, and bip  (PrimerDesign Inc)
90
PrimerDesign Inc lamp primers f3, b3, fip, and bip
List of primers used, their source, and expected product size
Lamp Primers F3, B3, Fip, And Bip, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b3+primers/six+primers++fi++bi++f3++b3++loop+f++and+loop+b+/pm40360926-58-0-13
Average 90 stars, based on 1 article reviews
lamp primers f3, b3, fip, and bip - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
f3 and b3 primer  (Carl Roth GmbH)
90
Carl Roth GmbH f3 and b3 primer
List of primers used, their source, and expected product size
F3 And B3 Primer, supplied by Carl Roth GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b3+primers/f3+and+b3+primer/pmc05364467__srep45085___s1-37-65-67
Average 90 stars, based on 1 article reviews
f3 and b3 primer - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
primers nep2_f3 and nep2_b3  (STAB VIDA)
90
STAB VIDA primers nep2_f3 and nep2_b3
List of primers used, their source, and expected product size
Primers Nep2 F3 And Nep2 B3, supplied by STAB VIDA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/b3+primers/primers+nep2+f3+and+nep2+b3/10__1094_slash_pdis___09___22___2046___re-78-12-14
Average 90 stars, based on 1 article reviews
primers nep2_f3 and nep2_b3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


List of primers used, their source, and expected product size

Journal: Malawi Medical Journal

Article Title: The use of molecular technology to investigate trypanosome infections in tsetse flies at Liwonde Wild Life Reserve

doi: 10.4314/mmj.v31i4.3

Figure Lengend Snippet: List of primers used, their source, and expected product size

Article Snippet: The RIME-LAMP 25 μl reaction mixture contained 10 μl of lyophilised master mix containing dNTPs, Bsm polymerase, MgCl2, 5 μl of 5× reaction buffer (Thermo Scientific, USA), 1.0 μl of the outer forward primer (F3), 1.0 μl of the outer backward primer (B3), 1.0 μl of the forward inner primer (FIP), 1.0 μl of the backward inner primer (BIP), 1.0 μl of each of the loop forward and loop backward primers, LF & LB (Microsynth, Sweden), 2.0 μl of nuclease free water and 2.0 μl of template DNA.

Techniques: